GSP
Quick Navigator

Search Site

Unix VPS
A - Starter
B - Basic
C - Preferred
D - Commercial
MPS - Dedicated
Previous VPSs
* Sign Up! *

Support
Contact Us
Online Help
Handbooks
Domain Status
Man Pages

FAQ
Virtual Servers
Pricing
Billing
Technical

Network
Facilities
Connectivity
Topology Map

Miscellaneous
Server Agreement
Year 2038
Credits
 

USA Flag

 

 

Man Pages


Manual Reference Pages  -  BIO::MAP::MICROSATELLITE (3)

.ds Aq ’

NAME

Bio::Map::Microsatellite - An object representing a Microsatellite marker.

CONTENTS

SYNOPSIS



  $o_usat = Bio::Map::Microsatellite->new
      (-name=>Chad Super Marker 2,
       -sequence => gctgactgatcatatatatatatatatatatatatatatatcgcgatcgtga,
       -motif => at,
       -repeats => 15,
       -repeat_start_position => 11
       );

  $sequence_before_usat = $o_usat->get_leading_flank();
  $sequence_after_usat = $o_usat->get_trailing_flank();



DESCRIPTION

This object handles the notion of an Microsatellite. This microsatellite can be placed on a (linear) Map or used on its own. If this Microsatellites will be used in a mapping context (it doesn’t have to, you know) it can have multiple positions in a map. For information about a Microsatellite’s position in a map one must query the associate PositionI object which is accessible through the position() method.

FEEDBACK

    Mailing Lists

User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to the Bioperl mailing list. Your participation is much appreciated.



  bioperl-l@bioperl.org                  - General discussion
  http://bioperl.org/wiki/Mailing_lists  - About the mailing lists



    Support

Please direct usage questions or support issues to the mailing list:

bioperl-l@bioperl.org

rather than to the module maintainer directly. Many experienced and reponsive experts will be able look at the problem and quickly address it. Please include a thorough description of the problem with code and data examples if at all possible.

    Reporting Bugs

Report bugs to the Bioperl bug tracking system to help us keep track of the bugs and their resolution. Bug reports can be submitted via the web:



  https://github.com/bioperl/bioperl-live/issues



AUTHOR - Chad Matsalla

Email bioinformatics1@dieselwurks.com

CONTRIBUTORS

Heikki Lehvaslaiho heikki-at-bioperl-dot-org Lincoln Stein lstein@cshl.org Jason Stajich jason@bioperl.org Sendu Bala bix@sendu.me.uk

APPENDIX

The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _

    new



 Title   : new
 Usage   : $o_usat =
 Function: Builds a new Bio::Map::Microsatellite object
 Returns : Bio::Map::Microsatellite
 Args    :
        -name    => name of this microsatellite (optional, string,
                default Unknown microsatellite)
        -positions => position(s) for this marker in maps[optional],
                An array reference of tuples (array refs themselves)
                Each tuple conatins a Bio::Map::MapI-inherited object and a
                Bio::Map::PositionI-inherited obj, no default)
        -sequence => the sequence of this microsatellite (optional,
                 scalar, no default)
        -motif => the repeat motif of this microsatellite (optional,
                 scalar, no default)
        -repeats => the number of motif repeats for this microsatellite
                (optional, scalar, no default)
        -repeat_start_position => the starting position of the
                microsatellite in this sequence. The first base of the
                sequence is position "1". (optional, scalar, no default)

 Note    : Creating a Bio::Map::Microsatellite object with no position
        might be useful for microsatellite people wanting to embrace
        and extend this module. <raising hand> Me! Me! Me!
        - using repeat_start_position will trigger a mechinism to
        calculate a value for repeat_end_position.



    motif



 Title   : motif
 Usage   : $o_usat->motif($new_motif);
               my $motif = $o_usat->motif();
 Function: Get/Set the repeat motif for this Microsatellite.
 Returns : A scalar representing the current repeat motif of this
               Microsatellite.
 Args    : none to get, OR string to set



    sequence



 Title   : sequence
 Usage   : $o_usat->sequence($new_sequence);
               my $sequence = $o_usat->sequence();
 Function: Get/Set the sequence for this Microsatellite.
 Returns : A scalar representing the current sequence of this
               Microsatellite.
 Args    : none to get, OR string to set



    repeats



 Title   : repeats
 Usage   : $o_usat->repeats($new_repeats);
               my $repeats = $o_usat->repeats()
 Function: Get/Set the repeat repeats for this Microsatellite.
 Returns : A scalar representing the current number of repeats of this
               Microsatellite.
 Args    : none to get, OR int to set



    repeat_start_position



 Title   : repeat_start_position
 Usage   : $o_usat->repeat_start_position($new_repeat_start_position);
               my $repeat_start_position = $o_usat->repeat_start_position();
 Function: Get/Set the repeat repeat_start_position for this
               Microsatellite
 Returns : A scalar representing the repeat start position for this
               Microsatellite.
 Args    : none to get, OR string to set
               This method will also try to set the repeat end position. This
               depends on having information for the motif and the number of
               repeats. If you want to use methods like get_trailing_flank or
               get_leading flank, be careful to include the right information.



    repeat_end_position



 Title   : repeat_end_position
 Usage   : $o_usat->repeat_end_position("set");
               $o_usat->repeat_end_position($value);
               $current_repeat_end_position = $o_usat->repeat_end_position();
 Function: Get/set the end position of the repeat in this sequence.
 Returns : A scalar representing the base index of the end of the
               repeat in this Microsatellite. The first base in the sequence
               is base 1.
 Args    : A scalar representing a value, the string "set", or no
               argument (see Notes).
 Notes   : If you do not provide an argument to this method, the current
           end position of the repeat in this Microsatellite will be
           returned (a scalar).
           If you provide the string "set" to this method it will set the
           end position based on the start position, the length of the
           motif, and the number of repeats.
           If you specify a value the current end position of the repeat
           will be set to that value. This is a really bad idea. Dont do
           it.



    equals



 Title   : equals
 Usage   : if ($mappable->equals($mapable2)) {...}
 Function: Test if a position is equal to another position
 Returns : boolean
 Args    : Bio::Map::MappableI



    less_than



 Title   : less_than
 Usage   : if ($mappable->less_than($m2)) {...}
 Function: Tests if a position is less than another position
 Returns : boolean
 Args    : Bio::Map::MappableI



    greater_than



 Title   : greater_than
 Usage   : if ($mappable->greater_than($m2)) {...}
 Function: Tests if position is greater than another position
 Returns : boolean
 Args    : Bio::Map::MappableI



    get_leading_flank



 Title   : get_leading_flank
 Usage   : $leading_sequence = $o_usat->get_leading_flank();
 Returns : A scalar representing the sequence before the repeats in this
               Microsatellite.
 Args    : none



    get_trailing_flank



 Title   : get_trailing_flank
 Usage   : $trailing_flank = $o_usat->get_trailing_flank();
 Returns : A scalar representing the sequence after the repeats in this
               Microsatellite.
 Args    : none



Search for    or go to Top of page |  Section 3 |  Main Index


perl v5.20.3 BIO::MAP::MICROSATELLITE (3) 2016-04-05

Powered by GSP Visit the GSP FreeBSD Man Page Interface.
Output converted with manServer 1.07.