GSP
Quick Navigator

Search Site

Unix VPS
A - Starter
B - Basic
C - Preferred
D - Commercial
MPS - Dedicated
Previous VPSs
* Sign Up! *

Support
Contact Us
Online Help
Handbooks
Domain Status
Man Pages

FAQ
Virtual Servers
Pricing
Billing
Technical

Network
Facilities
Connectivity
Topology Map

Miscellaneous
Server Agreement
Year 2038
Credits
 

USA Flag

 

 

Man Pages


Manual Reference Pages  -  BIO::PERL (3)

.ds Aq ’

NAME

Bio::Perl - Functional access to BioPerl for people who don’t know objects

CONTENTS

SYNOPSIS



  use Bio::Perl;

  # will guess file format from extension
  $seq_object = read_sequence($filename);

  # forces genbank format
  $seq_object = read_sequence($filename,genbank);

  # reads an array of sequences
  @seq_object_array = read_all_sequences($filename,fasta);

  # sequences are Bio::Seq objects, so the following methods work
  # for more info see Bio::Seq, or do perldoc Bio/Seq.pm

  print "Sequence name is ",$seq_object->display_id,"\n";
  print "Sequence acc  is ",$seq_object->accession_number,"\n";
  print "First 5 bases is ",$seq_object->subseq(1,5),"\n";

  # get the whole sequence as a single string

  $sequence_as_a_string = $seq_object->seq();

  # writing sequences

  write_sequence(">$filename",genbank,$seq_object);

  write_sequence(">$filename",genbank,@seq_object_array);

  # making a new sequence from just a string

  $seq_object = new_sequence("ATTGGTTTGGGGACCCAATTTGTGTGTTATATGTA",
      "myname","AL12232");

  # getting a sequence from a database (assumes internet connection)

  $seq_object = get_sequence(swissprot,"ROA1_HUMAN");

  $seq_object = get_sequence(embl,"AI129902");

  $seq_object = get_sequence(genbank,"AI129902");

  # BLAST a sequence (assummes an internet connection)

  $blast_report = blast_sequence($seq_object);

  write_blast(">blast.out",$blast_report);



DESCRIPTION

Easy first time access to BioPerl via functions.

FEEDBACK

    Mailing Lists

User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated.



  bioperl-l@bioperl.org



    Support

Please direct usage questions or support issues to the mailing list:

bioperl-l@bioperl.org

rather than to the module maintainer directly. Many experienced and reponsive experts will be able look at the problem and quickly address it. Please include a thorough description of the problem with code and data examples if at all possible.

    Reporting Bugs

Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via the web:



  https://github.com/bioperl/bioperl-live/issues



AUTHOR - Ewan Birney

Email birney@ebi.ac.uk

APPENDIX

The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _

    read_sequence



 Title   : read_sequence
 Usage   : $seq = read_sequence(sequences.fa)
           $seq = read_sequence($filename,genbank);

           # pipes are fine
           $seq = read_sequence("my_fetching_program $id |",fasta);

 Function: Reads the top sequence from the file. If no format is given, it will
           try to guess the format from the filename. If a format is given, it
           forces that format. The filename can be any valid perl open() string
           - in particular, you can put in pipes

 Returns : A Bio::Seq object. A quick synopsis:
           $seq_object->display_id - name of the sequence
           $seq_object->seq        - sequence as a string

 Args    : Two strings, first the filename - any Perl open() string is ok
           Second string is the format, which is optional



For more information on Seq objects see Bio::Seq.

    read_all_sequences



 Title   : read_all_sequences
 Usage   : @seq_object_array = read_all_sequences($filename);
           @seq_object_array = read_all_sequences($filename,genbank);

 Function: Just as the function above, but reads all the sequences in the
           file and loads them into an array.

           For very large files, you will run out of memory. When this
           happens, youve got to use the SeqIO system directly (this is
           not so hard! Dont worry about it!).

 Returns : array of Bio::Seq objects

 Args    : two strings, first the filename (any open() string is ok)
           second the format (which is optional)



See Bio::SeqIO and Bio::Seq for more information

    write_sequence



 Title   : write_sequence
 Usage   : write_sequence(">new_file.gb",genbank,$seq)
           write_sequence(">new_file.gb",genbank,@array_of_sequence_objects)

 Function: writes sequences in the specified format

 Returns : true

 Args    : filename as a string, must provide an open() output file
           format as a string
           one or more sequence objects



    new_sequence



 Title   : new_sequence
 Usage   : $seq_obj = new_sequence("GATTACA", "kino-enzyme");

 Function: Construct a sequency object from sequence string
 Returns : A Bio::Seq object

 Args    : sequence string
           name string (optional, default "no-name-for-sequence")
           accession - accession number (optional, no default)



    blast_sequence



 Title   : blast_sequence
 Usage   : $blast_result = blast_sequence($seq)
           $blast_result = blast_sequence(MFVEGGTFASEDDDSASAEDE);

 Function: If the computer has Internet accessibility, blasts
           the sequence using the NCBI BLAST server against nrdb.

           It chooses the flavour of BLAST on the basis of the sequence.

           This function uses Bio::Tools::Run::RemoteBlast, which itself
           use Bio::SearchIO - as soon as you want to know more, check out
           these modules
 Returns : Bio::Search::Result::GenericResult.pm

 Args    : Either a string of protein letters or nucleotides, or a
           Bio::Seq object



    write_blast



 Title   : write_blast
 Usage   : write_blast($filename,$blast_report);

 Function: Writes a BLAST result object (or more formally
           a SearchIO result object) out to a filename
           in BLAST-like format

 Returns : none

 Args    : filename as a string
           Bio::SearchIO::Results object



    get_sequence



 Title   : get_sequence
 Usage   : $seq_object = get_sequence(swiss,"ROA1_HUMAN");

 Function: If the computer has Internet access this method gets
           the sequence from Internet accessible databases. Currently
           this supports Swissprot (swiss), EMBL (embl), GenBank
           (genbank), GenPept (genpept), and RefSeq (refseq).

           Swissprot and EMBL are more robust than GenBank fetching.

           If the user is trying to retrieve a RefSeq entry from
           GenBank/EMBL, the query is silently redirected.

 Returns : A Bio::Seq object

 Args    : database type - one of swiss, embl, genbank, genpept, or
           refseq



    translate



 Title   : translate
 Usage   : $seqobj = translate($seq_or_string_scalar)

 Function: translates a DNA sequence object OR just a plain
           string of DNA to amino acids
 Returns : A Bio::Seq object

 Args    : Either a sequence object or a string of
           just DNA sequence characters



    translate_as_string



 Title   : translate_as_string
 Usage   : $seqstring = translate_as_string($seq_or_string_scalar)

 Function: translates a DNA sequence object OR just a plain
           string of DNA to amino acids
 Returns : A string of just amino acids

 Args    : Either a sequence object or a string of
           just DNA sequence characters



    reverse_complement



 Title   : reverse_complement
 Usage   : $seqobj = reverse_complement($seq_or_string_scalar)

 Function: reverse complements a string or sequence argument
           producing a Bio::Seq - if you want a string, you
           can use reverse_complement_as_string
 Returns : A Bio::Seq object

 Args    : Either a sequence object or a string of
           just DNA sequence characters



    revcom



 Title   : revcom
 Usage   : $seqobj = revcom($seq_or_string_scalar)

 Function: reverse complements a string or sequence argument
           producing a Bio::Seq - if you want a string, you
           can use reverse_complement_as_string

           This is an alias for reverse_complement
 Returns : A Bio::Seq object

 Args    : Either a sequence object or a string of
           just DNA sequence characters



    reverse_complement_as_string



 Title   : reverse_complement_as_string
 Usage   : $string = reverse_complement_as_string($seq_or_string_scalar)

 Function: reverse complements a string or sequence argument
           producing a string
 Returns : A string of DNA letters

 Args    : Either a sequence object or a string of
           just DNA sequence characters



    revcom_as_string



 Title   : revcom_as_string
 Usage   : $string = revcom_as_string($seq_or_string_scalar)

 Function: reverse complements a string or sequence argument
           producing a string
 Returns : A string of DNA letters

 Args    : Either a sequence object or a string of
           just DNA sequence characters



Search for    or go to Top of page |  Section 3 |  Main Index


perl v5.20.3 BIO::PERL (3) 2016-04-05

Powered by GSP Visit the GSP FreeBSD Man Page Interface.
Output converted with manServer 1.07.