GSP
Quick Navigator

Search Site

Unix VPS
A - Starter
B - Basic
C - Preferred
D - Commercial
MPS - Dedicated
* Sign Up! *

Support
Customer Portal
Contact Us
Online Help
Handbooks
Domain Status
Man Pages

FAQ
Virtual Servers
Pricing
Billing
Technical

Network
Facilities
Connectivity
Topology Map

Miscellaneous
Server Agreement
Year 2038
Credits
 

USA Flag

 

 

Man Pages
BP_FLANKS(1) User Contributed Perl Documentation BP_FLANKS(1)

bp_flanks - finding flanking sequences for a variant in a sequence position

  bp_flanks --position POS [-p POS ...]  [--flanklen INT]
         accession | filename

This script allows you to extract a subsequence around a region of interest from an existing sequence. The output if fasta formatted sequence entry where the header line contains additional information about the location.

The script takes one unnamed argument which be either a file name in the local file system or a nucleotide sequence accession number.

  -p         Position uses simple nucleotide sequence feature table
  --position notation to define the region of interest, typically a
             SNP or microsatellite repeat around which the flanks are
             defined.
             There can be more than one position option or you can
             give a comma separated list to one position option.
             The format of a position is:
                 [id:] int | range | in-between [-]
             The optional id is the name you want to call the new
             sequence. If it not given in joins running number to the
             entry name with an underscore.
             The position is either a point (e.g. 234), a range (e.g
             250..300) or insertion point between nucleotides
             (e.g. 234^235)
             If the position is not completely within the source
             sequence the output sequence will be truncated and it
             will print a warning.
             The optional hyphen [-] at the end of the position
             indicates that that you want the retrieved sequence to be
             in the opposite strand.
  -f         Defaults to 100. This is the length of the nucleotides
  --flanklen sequence retrieved on both sides of the given position.
             If the source file does not contain

The output is a fasta formatted entry where the description file contains tag=value pairs for information about where in the original sequence the subsequence was taken.

The ID of the fasta entry is the name given at the command line joined by hyphen to the filename or accesion of the source sequence. If no id is given a series of consecutive integers is used.

The tag=value pairs are:

position in the source file
strand of the sequence compared to the source sequence
position of the region of interest in the current entry. The tag is the same as used by dbSNP@NCBI

The sequence highlights the allele variant position by showing it in upper case and rest of the sequence in lower case characters.

  % bp_flanks ~/seq/ar.embl
  >1_/HOME/HEIKKI/SEQ/AR.EMBL oripos=100 strand=1 allelepos=100
  taataactcagttcttatttgcacctacttcagtggacactgaatttggaaggtggagga
  ttttgtttttttcttttaagatctgggcatcttttgaatCtacccttcaagtattaagag
  acagactgtgagcctagcagggcagatcttgtccaccgtgtgtcttcttctgcacgagac
  tttgaggctgtcagagcgct

The input files are assumed to be in EMBL format and the sequences are retrieved only from the EMB database. Make this more generic and use the registry.

head1 FEEDBACK

User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to the Bioperl mailing lists Your participation is much appreciated.

  bioperl-l@bioperl.org                  - General discussion
  http://bioperl.org/wiki/Mailing_lists  - About the mailing lists

Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via the web:

  https://github.com/bioperl/bioperl-live/issues

Email: <heikki-at-bioperl-dot-org>

2020-01-06 perl v5.42.2

Search for    or go to Top of page |  Section 1 |  Main Index

Powered by GSP Visit the GSP FreeBSD Man Page Interface.
Output converted with ManDoc.