|
NAMELocARNA - manual page for LocARNA 2.0.0 DESCRIPTIONlocarna - pairwise (global and local) alignment of RNA. USAGE: locarna [options] <Input 1> <Input 2> locarna is the pairwise alignment tool of the LocARNA package, which performs fast simultaneous folding and alignment based on two RNA sequences (or alignments). InputInput consists of two sequences or alignments, which are specified in fasta, clustal, stockholm, or LocARNA pp format. Optionally, structure and anchor constraints can be specified in the input files. If alignments are given in the input, they are aligned without revising the gap structure within the given alignments. Unless specified, base pair probabilities of the input sequences or alignments are predicted using the ViennaRNA package. Optionally, base pair probability information can be passed for one or both input sequences (or alignments) using the input formats LocARNA PP 2.0 or ViennaRNA postscript dotplot format. ConstraintsAnchor and structure constraints can be specified in the input files. Anchor constraints for sequences (alignments) are defined by assigning names to sequence positions (alignment columns), respectively. The exact semantics is either strict or relaxed (controled by --relaxed-anchors). In strict semantics, anchor names have to be sorted lexicographically in the input as well as in the result alignment (in the sense that result columns receive inherit the name from one or both input positions, where conflicts are disallowed). In relaxed semantics, anchors of the same name are forced into the same alignment column. The actual syntax of the constraint specification depends on the file format (see Constraint Examples below). OutputThe final pairwise alignment is reported in standard and/or variants of the clustal and stockholm format, as well as LocARNA's own pp format. OPTIONS
Scoring parameters:
Partition function representation (for sequence envelopes):
Locality:
Output:
Heuristics for speed accuracy trade off:
Special sauce options:
MEA score:
Constraints:
Input files:
DISCLAIMERFor many purposes, it is more convenient to use the multiple alignment tool mlocarna (even for pairwise alignment). However, certain tasks --like aligning two specific alignments-- are supported only by the pairwise tool or can be better controlled. Note that the performance of locarna (as well as basically all tools in the LocARNA package) is often significantly improved by the use of suitable application-specific options, deviating from the default settings. REFERENCESIf you use locarna please cite us: Sebastian Will, Kristin Reiche, Ivo L. Hofacker, Peter F. Stadler, and Rolf Backofen. Inferring non-coding RNA families and classes by means of genome-scale structure-based clustering. PLOS Computational Biology, 3 no. 4 pp. e65, 2007. doi:10.1371/journal.pcbi.0030065 Sebastian Will, Tejal Joshi, Ivo L. Hofacker, Peter F. Stadler, and Rolf Backofen. LocARNA-P: Accurate boundary prediction and improved detection of structural RNAs. RNA, 18(5):900â.�14, 2012. doi:10.1261/rna.029041.111 AVAILABILITYThe latest LocARNA package release is available online at at Github https://github.com/s-will/LocARNA and http://www.bioinf.uni-freiburg.de/Software/LocARNA/ EXAMPLESIn the simplest case, the tool is called with two sequences in fasta format or two alignments in multiple fasta, clustal or stockholm format like
or
Note that input formats can be mixed like in
Constraint ExamplesAnchor and structure constraints can be specified in extended versions of the Clustal format, in the LocARNA PP 2.0 format, as well as in Stockholm format. Currently, the pairwise alignment tools of the package do not support constraints in fasta-like input. Here is an example of constraints in Clustal format: CLUSTAL W vhuU AGCUCACAACCGAACCCAUUUGGGAGGUUGUGAGCU fruA CC-UCGAGGG-GAACCCGAAA-GGGACCCGAGA-GG #S (<<<<<<<<<......xxxx...............) #A1 .............AAABB.................. #A2 .............12312.................. The syntax (and semantic) of structure constraint strings (prefixed by #S) is the one of RNAfold of the ViennaRNA package. Moreover, fixed structures prefixed by #FS are accepted; fixed structures can contain pseudoknots encodes by different bracket symbols. Anchors are specified by naming columns, where names can consist of several places, in the example each name consists of two characters, such that the names are A1, A2, A3, B1, B2 for the respective columns. Constraints in PP format are specified in the same way; however, in Stockholm format we use different prefixes, such that the example would look like # STOCKHOLM 1.0 vhuU AGCUCACAACCGAACCCAUUUGGGAGGUUGUGAGCU fruA CC-UCGAGGG-GAACCCGAAA-GGGACCCGAGA-GG #=GC cS (<<<<<<<<<......xxxx...............) #=GC cA1 .............AAABB.................. #=GC cA2 .............12312.................. The prefix for fixed structures is '#=GC cFS'. AUTHORThis man page is written and maintained by Sebastian Will. It is part of the LocARNA package. REPORTING BUGSReport bugs to <will (at) informatik.uni-freiburg.de>. COPYRIGHTCopyright 2005- Sebastian Will. The LocARNA package is released under GNU Public License v3.0 SEE ALSOThe LocARNA PP 2.0 format is described online at http://www.bioinf.uni-freiburg.de/Software/LocARNA/PP/
|