 |
|
| |
RNAALIFOLD(1) |
User Commands |
RNAALIFOLD(1) |
RNAalifold - manual page for RNAalifold 2.7.0
RNAalifold [options] [<input0.aln>]
[<input1.aln>]...
RNAalifold 2.7.0
calculate secondary structures for a set of aligned RNAs
Read aligned RNA sequences from stdin or file.aln and calculate
their minimum free energy (mfe) structure, partition function (pf) and base
pairing probability matrix. Currently, input alignments have to be in
CLUSTAL, Stockholm, FASTA, or MAF format. The input format must be set
manually in interactive mode (default is Clustal), but will be determined
automagically from the input file, if not expplicitly set. It returns the
mfe structure in bracket notation, its energy, the free energy of the
thermodynamic ensemble and the frequency of the mfe structure in the
ensemble to stdout. It also produces Postscript files with plots of the
resulting secondary structure graph ("alirna.ps") and a "dot
plot" of the base pairing matrix ("alidot.ps"). The file
"alifold.out" will contain a list of likely pairs sorted by
credibility, suitable for viewing with "AliDot.pl". Be warned that
output file will overwrite any existing files of the same name.
- -h, --help
- Print help and exit
- --detailed-help
- Print help, including all details and hidden options, and exit
- --full-help
- Print help, including hidden options, and exit
- -V, --version
- Print version and exit
- -v, --verbose
- Be verbose. (default=off)
- Lower the log level setting such that even INFO messages are passed
through.
- -q, --quiet
- Be quiet. (default=off)
- This option can be used to minimize the output of additional information
and non-severe warnings which otherwise might spam stdout/stderr.
- Command line options for input and output (pre-)processing
- -f,
--input-format=C|S|F|M
- File format of the input multiple sequence alignment (MSA).
- If this parameter is set, the input is considered to be in a particular
file format. Otherwise, the program tries to determine the file format
automatically, if an input file was provided in the set of parameters. In
case the input MSA is provided in interactive mode, or from a terminal
(TTY), the programs default is to assume CLUSTALW format. Currently, the
following formats are available: ClustalW ('C'), Stockholm 1.0 ('S'),
FASTA/Pearson ('F'), and MAF ('M').
- --mis
- Output "most informative sequence" instead of simple consensus:
For each column of the alignment output the set of nucleotides with
frequency greater than average in IUPAC notation.
- (default=off)
- -j,
--jobs[=number]
- Split batch input into jobs and start processing in parallel using
multiple threads. A value of 0 indicates to use as many parallel threads
as computation cores are available.
- (default=`0')
- Default processing of input data is performed in a serial fashion, i.e.
one alignment at a time. Using this switch, a user can instead start the
computation for many alignments in the input in parallel. RNAalifold will
create as many parallel computation slots as specified and assigns input
alignments of the input file(s) to the available slots. Note, that this
increases memory consumption since input alignments have to be kept in
memory until an empty compute slot is available and each running job
requires its own dynamic programming matrices.
- --unordered
- Do not try to keep output in order with input while parallel processing is
in place.
- (default=off)
- When parallel input processing (--jobs flag) is enabled, the order
in which input is processed depends on the host machines job scheduler.
Therefore, any output to stdout or files generated by this program will
most likely not follow the order of the corresponding input data set. The
default of RNAalifold is to use a specialized data structure to still keep
the results output in order with the input data. However, this comes with
a trade-off in terms of memory consumption, since all output must be kept
in memory for as long as no chunks of consecutive, ordered output are
available. By setting this flag, RNAalifold will not buffer individual
results but print them as soon as they have been computated.
- --noconv
- Do not automatically substitute nucleotide "T" with
"U".
- (default=off)
- -n,
--continuous-ids
- Use continuous alignment ID numbering when no alignment ID can be
retrieved from input data.
- (default=off)
- Due to its past, RNAalifold produces a specific set of output file names
for the first input alignment, "alirna.ps",
"alidot.ps", etc. But for all further alignments in the input,
it usually adopts a naming scheme based on IDs, which may be retrieved
from the input alignment's meta-data, or generated by a prefix followed by
an increasing counter. Setting this flag instructs RNAalifold to use the
ID naming scheme also for the first alignment.
- --auto-id
- Automatically generate an ID for each alignment.
- (default=off)
- The default mode of RNAalifold is to automatically determine an ID from
the input alignment if the input file format allows to do that. Alignment
IDs are, for instance, usually given in Stockholm 1.0 formatted input. If
this flag is active, RNAalifold ignores any IDs retrieved from the input
and automatically generates an ID for each alignment.
- --id-prefix=STRING
- Prefix for automatically generated IDs (as used in output file
names).
- (default=`alignment')
- If this parameter is set, each alignment will be prefixed with the
provided string. Hence, the output files will obey the following naming
scheme: "prefix_xxxx_ss.ps" (secondary structure plot),
"prefix_xxxx_dp.ps" (dot-plot), "prefix_xxxx_aln.ps"
(annotated alignment), etc. where xxxx is the alignment number beginning
with the second alignment in the input. Use this setting in conjunction
with the --continuous-ids flag to assign IDs beginning with the
first input alignment.
- --id-delim=CHAR
- Change the delimiter between prefix and increasing number for
automatically generated IDs (as used in output file names).
- (default=`_')
- This parameter can be used to change the default delimiter '_' between the
prefix string and the increasing number for automatically generated
ID.
- --id-digits=INT
- Specify the number of digits of the counter in automatically generated
alignment IDs.
- (default=`4')
- When alignments IDs are automatically generated, they receive an
increasing number, starting with 1. This number will always be left-padded
by leading zeros, such that the number takes up a certain width. Using
this parameter, the width can be specified to the users need. We allow
numbers in the range [1:18].
- --id-start=LONG
- Specify the first number in automatically generated alignment IDs.
- (default=`1')
- When alignment IDs are automatically generated, they receive an increasing
number, usually starting with 1. Using this parameter, the first number
can be specified to the users requirements. Note: negative numbers are not
allowed. Note: Setting this parameter implies continuous alignment IDs,
i.e. it activates the --continuous-ids flag.
- --filename-delim=CHAR
- Change the delimiting character used in sanitized filenames.
- (default=`ID-delimiter')
- This parameter can be used to change the delimiting character used while
sanitizing filenames, i.e. replacing invalid characters. Note, that the
default delimiter ALWAYS is the first character of the "ID
delimiter" as supplied through the --id-delim option. If the
delimiter is a whitespace character or empty, invalid characters will be
simply removed rather than substituted. Currently, we regard the following
characters as illegal for use in filenames: backslash '\', slash '/',
question mark '?', percent sign '%', asterisk '*', colon ':', pipe symbol
'|', double quote '"', triangular brackets '<' and '>'.
- --log-level=level
- Set log level threshold. (default=`2')
- By default, any log messages are filtered such that only warnings (level
2) or errors (level 3) are printed. This setting allows for specifying the
log level threshold, where higher values result in fewer information.
Log-level 5 turns off all messages, even errors and other critical
information.
- --log-file[=filename]
- Print log messages to a file instead of stderr.
(default=`RNAalifold.log')
- --log-time
- Include time stamp in log messages.
- (default=off)
- --log-call
- Include file and line of log calling function.
- (default=off)
- Select additional algorithms which should be included in the
calculations.
- -p,
--partfunc[=INT]
- Calculate the partition function and base pairing probability matrix in
addition to the mfe structure. Default is calculation of mfe structure
only.
- (default=`1')
- In addition to the MFE structure we print a coarse representation of the
pair probabilities in form of a pseudo bracket notation, followed by the
ensemble free energy, as well as the centroid structure derived from the
pair probabilities together with its free energy and distance to the
ensemble. Finally it prints the frequency of the mfe structure.
- An additionally passed value to this option changes the behavior of
partition function calculation: -p0 deactivates the calculation of
the pair probabilities, saving about 50% in runtime. This prints the
ensemble free energy 'dG=-kT ln(Z)'.
- --betaScale=DOUBLE
- Set the scaling of the Boltzmann factors. (default=`1.')
- The argument provided with this option is used to scale the thermodynamic
temperature in the Boltzmann factors independently from the temperature of
the individual loop energy contributions. The Boltzmann factors then
become 'exp(- dG/(kTn*betaScale))' where 'k' is the Boltzmann constant,
'dG' the free energy contribution of the state, 'T' the absolute
temperature and 'n' the number of sequences.
- -S,
--pfScale=DOUBLE
- In the calculation of the pf use scale*mfe as an estimate for the ensemble
free energy (used to avoid overflows).
- (default=`1.07')
- The default is 1.07, useful values are 1.0 to 1.2. Occasionally needed for
long sequences.
- --MEA[=gamma]
- Compute MEA (maximum expected accuracy) structure.
- (default=`1.')
- The expected accuracy is computed from the pair probabilities: each base
pair '(i,j)' receives a score '2*gamma*p_ij' and the score of an unpaired
base is given by the probability of not forming a pair. The parameter
gamma tunes the importance of correctly predicted pairs versus unpaired
bases. Thus, for small values of gamma the MEA structure will contain only
pairs with very high probability. Using --MEA implies -p for
computing the pair probabilities.
- --sci
- Compute the structure conservation index (SCI) for the MFE consensus
structure of the alignment.
- (default=off)
- -c, --circ
- Assume a circular (instead of linear) RNA molecule.
- (default=off)
- --bppmThreshold=cutoff
- Set the threshold/cutoff for base pair probabilities included in the
postscript output.
- (default=`1e-6')
- By setting the threshold the base pair probabilities that are included in
the output can be varied. By default only those exceeding '1e-6' in
probability will be shown as squares in the dot plot. Changing the
threshold to any other value allows for increase or decrease of data.
- -g, --gquad
- Incoorporate G-Quadruplex formation into the structure prediction
algorithm.
- (default=off)
- -s,
--stochBT=INT
- Stochastic backtrack. Compute a certain number of random structures with a
probability dependend on the partition function. See -p option in
RNAsubopt.
- --stochBT_en=INT
- same as -s option but also print out the energies and probabilities
of the backtraced structures.
- -N,
--nonRedundant
- Enable non-redundant sampling strategy.
- (default=off)
- --random-seed=INT
- Set the seed for the random number generator
- Command line options to interact with the structure constraints feature of
this program
- --maxBPspan=INT
- Set the maximum base pair span.
- (default=`-1')
- -C,
--constraint[=filename]
- Calculate structures subject to constraints. The constraining structure
will be read from 'stdin', the alignment has to be given as a file name on
the command line.
- (default=`')
- The program reads first the sequence, then a string containing constraints
on the structure encoded with the symbols:
- '.' (no constraint for this base)
- '|' (the corresponding base has to be paired
- 'x' (the base is unpaired)
- '<' (base i is paired with a base j>i)
- '>' (base i is paired with a base j<i)
- and matching brackets '(' ')' (base i pairs base j)
- With the exception of '|', constraints will disallow all pairs conflicting
with the constraint. This is usually sufficient to enforce the constraint,
but occasionally a base may stay unpaired in spite of constraints. PF
folding ignores constraints of type '|'.
- --batch
- Use constraints for all alignment records. (default=off)
- Usually, constraints provided from input file are only applied to a single
sequence alignment. Therefore, RNAalifold will stop its computation and
quit after the first input alignment was processed. Using this switch,
RNAalifold processes all sequence alignments in the input and applies the
same provided constraints to each of them.
- --enforceConstraint
- Enforce base pairs given by round brackets '(' ')' in structure
constraint.
- (default=off)
- --SS_cons
- Use consensus structures from Stockholm file ('#=GF SS_cons') as
constraint.
- (default=off)
- Stockholm formatted alignment files have the possibility to store a
secondary structure string in one of if ('#=GC') column annotation meta
tags. The corresponding tag name is usually 'SS_cons', a consensus
secondary structure. Activating this flag allows one to use this consensus
secondary structure from the input file as structure constraint.
Currently, only the following characters are interpreted:
- '(' ')' [mathing parenthesis: column i pairs with column j]
- '<' '>' [matching angular brackets: column i pairs with column
j]
- All other characters are not interpreted (yet). Note: Activating this flag
implies --constraint.
- --shape=file1,file2
- Use SHAPE reactivity data to guide structure predictions.
- Multiple shapefiles for the individual sequences in the alignment may be
specified as a comma separated list. An optional association of particular
shape files to a specific sequence in the alignment can be expressed by
prepending the sequence number to the filename, e.g.
"5=seq5.shape,3=seq3.shape" will assign the reactivity values
from file seq5.shape to the fifth sequence in the alignment, and the
values from file seq3.shape to sequence 3. If no assignment is specified,
the reactivity values are assigned to corresponding sequences in the order
they are given.
- --shapeMethod=D[mX][bY]
- Specify the method how to convert SHAPE reactivity data to pseudo energy
contributions.
- (default=`D')
- Currently, the only data conversion method available is that of to Deigan
et al 2009. This method is the default and is recognized by a capital 'D'
in the provided parameter, i.e.: --shapeMethod="D" is the
default setting. The slope 'm' and the intercept 'b' can be set to a
non-default value if necessary. Otherwise m=1.8 and b=-0.6 as stated in
the paper mentionen before. To alter these parameters, e.g. m=1.9 and
b=-0.7, use a parameter string like this:
--shapeMethod="Dm1.9b-0.7". You may also provide only one
of the two parameters like: --shapeMethod="Dm1.9" or
--shapeMethod="Db-0.7".
- Energy parameter sets can be adapted or loaded from user-provided input
files
- -T,
--temp=DOUBLE
- Rescale energy parameters to a temperature of temp C. Default is 37C.
- (default=`37.0')
- -P,
--paramFile=paramfile
- Read energy parameters from paramfile, instead of using the default
parameter set.
- Different sets of energy parameters for RNA and DNA should accompany your
distribution. See the RNAlib documentation for details on the file format.
The placeholder file name 'DNA' can be used to load DNA parameters without
the need to actually specify any input file.
- -4, --noTetra
- Do not include special tabulated stabilizing energies for tri-, tetra- and
hexaloop hairpins.
- (default=off)
- Mostly for testing.
- --salt=DOUBLE
- Set salt concentration in molar (M). Default is 1.021M.
- Tweak the energy model and pairing rules additionally using the following
parameters
- -d,
--dangles=INT
- How to treat "dangling end" energies for bases adjacent to
helices in free ends and multi-loops.
- (default=`2')
- With -d2 dangling energies will be added for the bases adjacent to
a helix on both sides
- in any case.
- The option -d0 ignores dangling ends altogether (mostly for
debugging).
- --noLP
- Produce structures without lonely pairs (helices of length 1).
- (default=off)
- For partition function folding this only disallows pairs that can only
occur isolated. Other pairs may still occasionally occur as helices of
length 1.
- --noGU
- Do not allow GU pairs.
- (default=off)
- --noClosingGU
- Do not allow GU pairs at the end of helices.
- (default=off)
- --cfactor=DOUBLE
- Set the weight of the covariance term in the energy function
- (default=`1.0')
- --nfactor=DOUBLE
- Set the penalty for non-compatible sequences in the covariance term of the
energy function
- (default=`1.0')
- -E, --endgaps
- Score pairs with endgaps same as gap-gap pairs.
- (default=off)
- -R,
--ribosum_file=ribosumfile
- use specified Ribosum Matrix instead of normal
- energy model.
- Matrixes to use should be 6x6 matrices, the order of the terms is 'AU',
'CG', 'GC', 'GU', 'UA', 'UG'.
- -r,
--ribosum_scoring
- use ribosum scoring matrix. (default=off)
- The matrix is chosen according to the minimal and maximal pairwise
identities of the sequences in the file.
- --old
- use old energy evaluation, treating gaps as characters.
- (default=off)
- --nsp=STRING
- Allow other pairs in addition to the usual AU,GC,and GU pairs.
- Its argument is a comma separated list of additionally allowed pairs. If
the first character is a "-" then AB will imply that AB and BA
are allowed pairs, e.g. --nsp="-GA" will allow GA and AG
pairs. Nonstandard pairs are given 0 stacking energy.
- --energyModel=INT
- Set energy model.
- Rarely used option to fold sequences from the artificial ABCD... alphabet,
where A pairs B, C-D etc. Use the energy parameters for GC
(--energyModel 1) or AU (--energyModel 2) pairs.
- --helical-rise=FLOAT
- Set the helical rise of the helix in units of Angstrom.
- (default=`2.8')
- Use with caution! This value will be re-set automatically to 3.4 in case
DNA parameters are loaded via -P DNA and no further value is
provided.
- --backbone-length=FLOAT
- Set the average backbone length for looped regions in units of
Angstrom.
- (default=`6.0')
- Use with caution! This value will be re-set automatically to 6.76 in case
DNA parameters are loaded via -P DNA and no further value is
provided.
- Command line options for changing the default behavior of structure layout
and pairing probability plots
- --color
- Produce a colored version of the consensus structure plot
"alirna.ps" (default b&w only)
- (default=off)
- --color-threshold=FLOAT
- Set the threshold of maximum counter examples for coloring consensus
structure plot.
- (default=`2')
- Floating point numbers between 0 and 1 are treated as frequencies among
all sequencesin the alignment. All other will be truncated to integer and
used as absolute number of counter examples.
- --color-min-sat=FLOAT
- Set the minimum saturation for coloring consensus structure plot.
- (default=`0.2')
- Floating point number >= 0 and smaller than 1.
- --aln
- Produce a colored and structure annotated alignment in PostScript format
in the file "aln.ps" in the current directory.
- (default=off)
- --aln-EPS-cols=INT
- Number of columns in colored EPS alignment output.
- (default=`60')
- A value less than 1 indicates that the output should not be wrapped at
all.
- --aln-stk[=prefix]
- Create a multi-Stockholm formatted output file.
(default=`RNAalifold_results')
- The default file name used for the output is
"RNAalifold_results.stk". Users may change the filename to
"prefix.stk" by specifying the prefix as optional argument. The
file will be create in the current directory if it does not already exist.
In case the file already exists, output will be appended to it. Note: Any
special characters in the filename will be replaced by the filename
delimiter, hence there is no way to pass an entire directory path through
this option yet. (See also the "--filename-delim"
parameter)
- --noPS
- Do not produce postscript drawing of the mfe structure.
- (default=off)
- --noDP
- Do not produce dot-plot postscript file containing base pair or stack
probabilitities.
- (default=off)
- In combination with the -p option, this flag turns-off creation of
individual dot-plot files. Consequently, computed base pair probability
output is omitted but centroid and MEA structure prediction is still
performed.
- -t,
--layout-type=INT
- Choose the layout algorithm. (default=`1')
- Select the layout algorithm that computes the nucleotide coordinates.
Currently, the following algorithms are available:
- '0': simple radial layout
- '1': Naview layout (Bruccoleri et al. 1988)
- '2': circular layout
- '3': RNAturtle (Wiegreffe et al. 2018)
- '4': RNApuzzler (Wiegreffe et al. 2018)
Caveats:
Sequences are not weighted. If possible, do not mix very similar
and dissimilar sequences. Duplicate sequences, for example, can distort the
prediction.
If you use this program in your work you might want to
cite:
R. Lorenz, S.H. Bernhart, C. Hoener zu Siederdissen, H. Tafer, C.
Flamm, P.F. Stadler and I.L. Hofacker (2011), "ViennaRNA Package
2.0", Algorithms for Molecular Biology: 6:26
I.L. Hofacker, W. Fontana, P.F. Stadler, S. Bonhoeffer, M. Tacker,
P. Schuster (1994), "Fast Folding and Comparison of RNA Secondary
Structures", Monatshefte f. Chemie: 125, pp 167-188
R. Lorenz, I.L. Hofacker, P.F. Stadler (2016), "RNA folding
with hard and soft constraints", Algorithms for Molecular Biology 11:1
pp 1-13
The algorithm is a variant of the dynamic programming algorithms
of M. Zuker and P. Stiegler (mfe) and J.S. McCaskill (pf) adapted for sets
of aligned sequences with covariance information.
Ivo L. Hofacker, Martin Fekete, and Peter F. Stadler (2002),
"Secondary Structure Prediction for Aligned RNA Sequences",
J.Mol.Biol.: 319, pp 1059-1066.
Stephan H. Bernhart, Ivo L. Hofacker, Sebastian Will, Andreas R.
Gruber, and Peter F. Stadler (2008), "RNAalifold: Improved consensus
structure prediction for RNA alignments", BMC Bioinformatics: 9, pp
474
The energy parameters are taken from:
D.H. Mathews, M.D. Disney, D. Matthew, J.L. Childs, S.J.
Schroeder, J. Susan, M. Zuker, D.H. Turner (2004), "Incorporating
chemical modification constraints into a dynamic programming algorithm for
prediction of RNA secondary structure", Proc. Natl. Acad. Sci. USA:
101, pp 7287-7292
D.H Turner, D.H. Mathews (2009), "NNDB: The nearest neighbor
parameter database for predicting stability of nucleic acid secondary
structure", Nucleic Acids Research: 38, pp 280-282
A simple call to compute consensus MFE structure, ensemble free
energy, base pair probabilities, centroid structure, and MEA structure for a
multiple sequence alignment (MSA) provided as Stockholm formatted file
alignment.stk might look like:
$ RNAalifold -p --MEA alignment.stk
Consider the following MSA file for three sequences
# STOCKHOLM 1.0
#=GF AC RF01293
#=GF ID ACA59
#=GF DE Small nucleolar RNA ACA59
#=GF AU Wilkinson A
#=GF SE Predicted; WAR; Wilkinson A
#=GF SS Predicted; WAR; Wilkinson A
#=GF GA 43.00
#=GF TC 44.90
#=GF NC 40.30
#=GF TP Gene; snRNA; snoRNA; HACA-box;
#=GF BM cmbuild -F CM SEED
#=GF CB cmcalibrate --mpi CM
#=GF SM cmsearch --cpu 4 --verbose --nohmmonly -E 1000 -Z 549862.597050 CM SEQDB
#=GF DR snoRNABase; ACA59;
#=GF DR SO; 0001263; ncRNA_gene;
#=GF DR GO; 0006396; RNA processing;
#=GF DR GO; 0005730; nucleolus;
#=GF RN [1]
#=GF RM 15199136
#=GF RT Human box H/ACA pseudouridylation guide RNA machinery.
#=GF RA Kiss AM, Jady BE, Bertrand E, Kiss T
#=GF RL Mol Cell Biol. 2004;24:5797-5807.
#=GF WK Small_nucleolar_RNA
#=GF SQ 3
AL031296.1/85969-86120 CUGCCUCACAACGUUUGUGCCUCAGUUACCCGUAGAUGUAGUGAGGGUAACAAUACUUACUCUCGUUGGUGAUAAGGAACAGCU
AANU01225121.1/438-603 CUGCCUCACAACAUUUGUGCCUCAGUUACUCAUAGAUGUAGUGAGGGUGACAAUACUUACUCUCGUUGGUGAUAAGGAACAGCU
AAWR02037329.1/29294-29150 ---CUCGACACCACU---GCCUCGGUUACCCAUCGGUGCAGUGCGGGUAGUAGUACCAAUGCUAAUUAGUUGUGAGGACCAACU
#=GC SS_cons -----((((,<<<<<<<<<___________>>>>>>>>>,,,,<<<<<<<______>>>>>>>,,,,,))))::::::::::::
#=GC RF CUGCcccaCAaCacuuguGCCUCaGUUACcCauagguGuAGUGaGgGuggcAaUACccaCcCucgUUgGuggUaAGGAaCAgCU
//
Then, the above program call will produce this output:
3 sequences; length of alignment 84.
>ACA59
CUGCCUCACAACAUUUGUGCCUCAGUUACCCAUAGAUGUAGUGAGGGUAACAAUACUUACUCUCGUUGGUGAUAAGGAACAGCU
...((((((.(((((((((...........))))))))).))))))..........(((((......)))))............ (-12.54 = -12.77 + 0.23)
...((((((.(((((((((...........))))))))).)))))){{,.......{{{{,......}))))............ [-14.38]
...((((((.(((((((((...........))))))))).))))))..........((((........))))............ {-12.44 = -12.33 + -0.10 d=10.94}
...((((((.(((((((((...........))))))))).))))))..........((((........))))............ {-12.44 = -12.33 + -0.10 MEA=66.65}
frequency of mfe structure in ensemble 0.368739; ensemble diversity 17.77
Here, the first line is written to stderr and simply states
the number of sequences and the length of the alignment. This line can be
suppressed using the --quiet option. The main output then consists of
7 lines, where the first two resemble the FASTA header with the ID as read
from the input data set, followed by the consensus sequence in the second
line. The third line consists of the consensus secondary structure in
dot-bracket notation followed by the averaged minimum free energy in
parenthesis. This energy is composed of two major contributions, the actual
free energies derived from the Nearest Neighbor model, and the covariance
pseudo-energy term, which are both displayed after the equal sign. The
fourth line shows the base pair propensity in pseudo dot-bracket notation
followed by the ensemble free energy dG = -kT ln(Z) in square brackets.
Similarly, the next two lines state the controid- and the MEA structure in
dot-bracket notation, followed by their corresponding free energy
contributions, the mean distance (d) to the ensemble as well as the maximum
expected accuracy (MEA). Again, the free energies are split into Nearest
Neighbor contribution and the covariance pseudo-energy term.
Furthermore, RNAalifold will produce three output files:
ACA59_ss.ps, ACA59_dp.ps, and ACA59_ali.out that contain the secondary
structure drawing, the base pair probability dot-plot, and a detailed table
of base pair probabilities, respectively.
When computing base pair probabilities (--partfunc option),
RNAalifold will produce a file with the suffix `ali.out`. This file contains
the base pairing probabilities between different alignment columns together
with some detailed statistics for the individual sequences within the
alignment. The file is a simple text file with a two line header that states
the number of sequences and length of the alignment. The first couple of
lines of this file may look like:
3 sequence; length of alignment 84
alifold output
14 36 0 92.7% 0.212 CG:1 UA:2
13 37 0 92.7% 0.218 GU:1 AU:2
12 38 0 92.7% 0.231 CG:3
15 35 0 91.9% 0.239 UG:3
16 34 0 85.2% 0.434 UA:2 --:1
8 42 0 80.7% 0.526 AU:3 +
9 41 0 80.4% 0.542 CG:3 +
7 43 1 80.1% 0.541 CG:2 +
Starting with the third row, there are at least six and at most 13
columns separated by whitespaces stating: (1) the i-position and (2) the
j-position of a potential base pair (i, j), followed by (3) the number of
counter examples, i.e. the number of sequences in the alignment that can't
form a canonical base pair with their respective sequence positions. Next is
(4) the base pair probabilitiy in percent, (5) a pseudo entropy measure S_ij
= S_i + S_j - p_ij ln(p_ij), where S_i and S_j are the positional entropies
for the two alignment columns i and j, and p_ij is the base pair
probability. Finally, the last columns (6-12) state the number of particular
base pairs for the individual sequences in the alignment. Here, we
distinguish the base pairs
"GC","CG","AU","UA","GU","UG",
and the special case "--" that represents gaps at both positions i
and j. Finally, base pairs that are not part of the MFE structure are marked
by an additional "+" sign in the last column.
Ivo L Hofacker, Stephan Bernhart, Ronny Lorenz
If in doubt our program is right, nature is at fault. Comments
should be sent to rna@tbi.univie.ac.at.
The ALIDOT package http://www.tbi.univie.ac.at/RNA/Alidot/
Visit the GSP FreeBSD Man Page Interface. Output converted with ManDoc.
|