NAME

SYNOPSIS

DESCRIPTION

Calculate the thermodynamics of RNA-RNA interactions

RNAup calculates the thermodynamics of RNA-RNA interactions, by decomposing the binding into two stages. (1) First the probability that a potential binding sites remains unpaired (equivalent to the free energy needed to open the site) is computed. (2) Then this accessibility is combined with the interaction energy to obtain the total binding energy. All calculations are done by computing partition functions over all possible conformations.

RNAup provides two different modes: By default RNAup computes accessibilities, in terms of the free energies needed to open a region (default length 4). It prints the region of highest accessibility and its opening energy to stdout, opening energies for all other regions are written to a file.

In interaction mode the interaction between two RNAs is calculated. It is invoked if the input consists of two sequences concatenated with an "&", or if the options -X[pf] or -b are given. Unless the -b option is specified RNAup assumes that the longer RNA is a structured target sequence while the shorter one is an unstructured small RNA.
Additionally, for every position along the target sequence we write the best free energy of binding for an interaction that includes this position to the the output file. Output to stdout consists of the location and free energy, dG, for the optimal region of interaction. The binding energy dG is also split into its components the interaction energy dGint and the opening energy dGu_l (and possibly dGu_s for the shorter sequence).
In addition we print the optimal interaction structure as computed by RNAduplex for this region. Note that it can happen that the RNAduplex computed optimal interaction does not coincide with the optimal RNAup region. If the two predictions don't match the structure string is replaced by a run of "." and a message is written to stderr.

Each sequence should be in 5' to 3' direction. If the sequence is preceded by a line of the form

> name

the output file "name_ux_up.out" is produced, where the "x" in "ux" is the value set by the -u option. Otherwise the file name defaults to RNA_ux_up.out. The output is concatenated if a file with the same name exists.

RNA sequences are read from stdin as strings of characters. White space and newline within a sequence cause an error! Newline is used to separate sequences. The program will continue to read new sequences until a line consisting of the single character @ or an end of file condition is encountered.

-h, --help

Print help and exit

--detailed-help

Print help, including all details and hidden options, and exit

--full-help

Print help, including hidden options, and exit

-V, --version

Print version and exit

REFERENCES

R. Lorenz, S.H. Bernhart, C. Hoener zu Siederdissen, H. Tafer, C. Flamm, P.F. Stadler and I.L. Hofacker (2011), "ViennaRNA Package 2.0", Algorithms for Molecular Biology: 6:26

I.L. Hofacker, W. Fontana, P.F. Stadler, S. Bonhoeffer, M. Tacker, P. Schuster (1994), "Fast Folding and Comparison of RNA Secondary Structures", Monatshefte f. Chemie: 125, pp 167-188

R. Lorenz, I.L. Hofacker, P.F. Stadler (2016), "RNA folding with hard and soft constraints", Algorithms for Molecular Biology 11:1 pp 1-13

U. Mueckstein, H. Tafer, J. Hackermueller, S.H. Bernhart, P.F. Stadler, and I.L. Hofacker (2006), "Thermodynamics of RNA-RNA Binding", Bioinformatics: 22(10), pp 1177-1182

The energy parameters are taken from:

D.H. Mathews, M.D. Disney, D. Matthew, J.L. Childs, S.J. Schroeder, J. Susan, M. Zuker, D.H. Turner (2004), "Incorporating chemical modification constraints into a dynamic programming algorithm for prediction of RNA secondary structure", Proc. Natl. Acad. Sci. USA: 101, pp 7287-7292

D.H Turner, D.H. Mathews (2009), "NNDB: The nearest neighbor parameter database for predicting stability of nucleic acid secondary structure", Nucleic Acids Research: 38, pp 280-282

EXAMPLES

In Interaction mode RNAup prints the most favorable interaction energy between the two sequences to stdout. The most favorable interaction energy (dG) depends on the position in the longer sequence (region [i,j]) and the position in the shorter sequence (region[k,l]): dG[i,j;k,l]. dG[i,j;k,l] is the largest contribution to dG[i,j] = sum_kl dG[i,j;k,l] which is given in the output file: therefore dG[i,j;k,l] <= dG[i,j].

  '....,....1....,....2....,....3....,....4....,....5....,....6....,....7....,....8'
  > franz
  GGAGUAGGUUAUCCUCUGUU
  > sissi
  AGGACAACCU
  dG = dGint + dGu_l
  (((((.((((&)))).)))))   6,15  :   1,10  (-6.66 = -9.89 + 3.23)
  AGGUUAUCCU&AGGACAACCU
  RNAup output in file: franz_sissi_w25_u3_4_up.out

where the result line contains following information

  RNAduplex results       [i,j]     [k,l]    dG = dGint + dGu_l
  (((((.((((&)))).)))))   6,15   :  1,10     (-6.66=-9.89+3.23)

Output to file:

Output to file contains a header including date, the command line of the call to RNAup, length and names of the input sequence(s) followed by the sequence(s). The first sequence is the target sequence. Printing of the header can be turned off using the -nh option.

The line directly after the header gives the column names for the output:

  position     dGu_l for -u 3      dGu_l for -u 4       dG
#     pos      u3S       u3H       u4S       u4H        dG

where all information refers to the target sequence. The dGu_l column contains information about the -u value (u=3 or u=4) and the contribution to the free energy to open all structures "S" or only hairpin loops "H", see option -c. NA means that no results is possible (e.g. column u3S row 2: no region of length 3 ending at position 2 exists).

#  Thu Apr 10 09:15:11 2008
#  RNAup -u 3,4 -c SH -b
#  20 franz
#  GGAGUAGGUUAUCCUCUGUU
#  10 sissi
#  AGGACAACCU
#     pos      u3S       u3H       u4S       u4H        dG
       1        NA        NA        NA        NA    -1.540
       2        NA        NA        NA        NA    -1.540
       3     1.371        NA        NA        NA    -1.217
       4     1.754     5.777     1.761        NA    -1.393
       5     1.664     3.140     1.811     5.800    -1.393

If the -b option is selected position and dGu_s values for the shorter sequence are written after the information for the target sequence.

AUTHOR

REPORTING BUGS