 |
|
| |
| VCFCREATEMULTI(1) |
vcfcreatemulti (VCF transformation) |
VCFCREATEMULTI(1) |
vcfcreatemulti - collates single ALT allele records into
multi-allele records while tracking genotypes
vcfcreatemulti merges VCF records into one line by
combining ALT alleles into a single VCF record. This tool is a great
companion to vcfwave.
In 2022 vcfcreatemulti has been upgraded to track INFO
records and genotypes (samples) so they are updated in the output.
Note that the tool is not perfect: See below EXAMPLES, the caveat
on `too many variants' MULTI=ALTPROBLEM, and vcfwave for more
information.
- -h, –help
- shows help message and exits.
See more below.
-
>>> head("vcfcreatemulti -h",25)
>
Usage: vcfcreatemulti [options] [file]
>
Go through sorted VCF and when overlapping alleles are represented across multiple records, merge them into a single multi-ALT record. See the documentation for more information.
>
options:
>
--quiet no progress bar
--legacy legacy mode (old C++ implementation does not do genotypes)
>
Type: transformation
>
The original `legacy' vcfcreatemulti can combine overlapping
alleles onto one record (VCF line), but it does not correct the INFO fields
and sample (genotypes). For example:
-
>>> sh("cat ../samples/10158243-after-vcfwave.vcf|grep -v ^\#")
grch38#chr4 10158244 >3655>3662_1 CCCCCACCCCCAC C 60 . AC=1;AF=0.011236;AN=89;AT=>3655>3656>3657>3660>3662;NS=45;LV=0;ORIGIN=grch38#chr4:10158243;LEN=12;INV=0;TYPE=del GT 0|0 0|0 0|0 0|0 1|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0
grch38#chr4 10158244 >3655>3662_2 CCCCCACCCCCACC C 60 . AC=3;AF=0.033708;AN=89;AT=>3655>3656>3660>3662;NS=45;LV=0;ORIGIN=grch38#chr4:10158243;LEN=13;INV=0;TYPE=del GT 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 1|0 0|1 0|0 0|0 0|0 0|0 0|0 0|0 0|1 0|0 0
grch38#chr4 10158245 >3655>3662_3 CCCCACCCCCACC C 60 . AC=64;AF=0.719101;AN=89;AT=>3655>3656>3657>3658>3659>3660>3662;NS=45;LV=0;ORIGIN=grch38#chr4:10158243;LEN=12;INV=0;TYPE=del GT 0|0 1|1 1|1 1|0 0|1 0|0 0|1 0|1 1|1 1|1 1|1 1|1 1|1 1|1 1|1 0|0 1|1 1|1 1|1 1|0 1|0 1|0 1|0 1|1 1|1 1|0 1|1 1|1 0|0 1|0 1|1 0|1 1|1 1|1 0|1 1|0 1|1 1|1 0|1 1|1 1|1 1|0 1|0 1|1 0
grch38#chr4 10158251 >3655>3662_4 CCCCACC C 60 . AC=3;AF=0.033708;AN=89;AT=>3655>3656>3657>3658>3660>3662;NS=45;LV=0;ORIGIN=grch38#chr4:10158243;LEN=6;INV=0;TYPE=del GT 0|0 0|0 0|0 0|0 0|0 0|1 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 1|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|1 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0
grch38#chr4 10158256 >3655>3662_5 CC C 60 . AC=2;AF=0.022472;AN=89;AT=>3655>3660>3662;NS=45;LV=0;ORIGIN=grch38#chr4:10158243;LEN=1;INV=0;TYPE=del GT 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|1 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 1|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0
grch38#chr4 10158257 >3655>3662_6 C A 60 . AC=1;AF=0.011236;AN=89;AT=>3655>3656>3657>3660>3662;NS=45;LV=0;ORIGIN=grch38#chr4:10158243;LEN=1;INV=0;TYPE=snp GT 0|0 .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. .|. 0
this now gets converted into the following:
-
>>> sh("../build/vcfcreatemulti ../samples/10158243-after-vcfwave.vcf|grep -v ^\#")
grch38#chr4 10158244 >3655>3662_1 CCCCCACCCCCACC CC,C,CC,CCCCCACC,CCCCCACCCCCAC,CCCCCACCCCCACA 60 . AC=1,3,64,3,2,1;AF=0.011236,0.033708,0.719101,0.033708,0.022472,0.011236;AN=89,89,89,89,89,89;AT=>3655>3656>3657>3660>3662,>3655>3656>3660>3662,>3655>3656>3657>3658>3659>3660>3662,>3655>3656>3657>3658>3660>3662,>3655>3660>3662,>3655>3656>3657>3660>3662;NS=45;LV=0;ORIGIN=grch38#chr4:10158243;LEN=12;INV=0,0,0,0,0,0;TYPE=del,del,del,del,del,snp;combined=10158244-10158257 GT 0|0 3|3 3|3 3|0 1|3 0|4 0|3 0|3 3|3 3|3 3|3 3|3 3|3 3|3 3|3 4|5 3|3 3|3 3|3 3|0 3|0 3|0 3|0 3|3 3|3 3|4 3|3 3|3 5|0 3|0 3|3 0|3 3|3 3|3 2|3 3|2 3|3 3|3 0|3 3|3 3|3 3|0 3|2 3|3 0
Or the MULTI=ALTPROBLEM.
That looks proper. There is one caveat or blatant problem,
however. If a variant sequence is long (a large `bubble') and with the other
alleles more (small) INDELs are scored than there are samples then the
genotypes represent only the last match. Resulting in something ugly:
-
...,del,del,snp,ins,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,s np,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,s np,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp,snp;combined=36390210-36409660 GT
509|49 8 500|500 20|251 500|238 238|498 653|387 102|1 500|498 9|509 498|69 500|297 498|725 498|660 500|472 204|500 50 0|846 654|653 500|500 500|500 18|18 430|498 214|500 499|299 67|500 18|386 47|154 508|47 500|385 42|47 579|47 47|18 47|47 219|500 18|47 53|213 500|18 500|18 500|500 47|846 47|47 500|47 500|47 839|500 498|47 500
this is a simple artefact resulting from the fact that complex
structures do not map (easily) on the simple VCF layout. Another problem is
that multiple SNPs don’t get incorporated in the ALTs - the algorithm
uses the reference to build up the longer ALTs for every single SNP from the
start.
In this example you see that the ALT for SNP2 does not contain
SNP1 even though they may be in the same individual/sample:
-
sample
REF ACTGACTGACTG
ALT-SNP1 ACTGC 1/0
ALT-SNP2 ACTGACTA 1/0
^
In words: the result is incorrect.
At this point, for analysis, there is little else to do but go to
the original data (pangenome or VCF) and compare the results. What
vcfcreatemulti helps to do is point out that there is a complex region here
with ample variation and the resulting layout is a problem (too many ALTs as
in `too many cooks'!).
To help vcflib show’s a `WARNING: Too many ALT alleles to
fit in sample(s)’ and we add an INFO tag
“MULTI=ALTPROBLEM”. Searching for these will give an idea of
this issue. E.g.
-
grep MULTI= ./test/tmp/vcfcreatemulti_2.vcf -c
Finds 3 marked records. One of them is derived from the
combination:
-
grch38#chr8 36377478 >601>606 GTTTCTTGAAAAACCAAATGT GTTTCTTGAAAAACCAAAGGT,G 60 . AC=20,1;AF=0.224719,0.011236
;AN=89;AT=>601>602>603>605>606,>601>602>604>605>606,>601>606;NS=45;LV=0 GT 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0
0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 1|1 0|0 0|0 0|0 0|0 1|0 1|0 0|2 0|0 0|1 0|1 1|1 1|1 0|0 1|1 0|0 0|1 0|1
0|0 1|0 1|1 0|1 0|1 0|0 0|1 0
grch38#chr8 36377496 >602>605 T G 60 . AC=20;AF=0.227273;AN=88;AT=>602>603>605,>602>604>605;NS=45;LV=1;PS=>60
1>606 GT 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 1|1 0|0 0|0 0|0 0|0 1|0 1|
0 0|. 0|0 0|1 0|1 1|1 1|1 0|0 1|1 0|0 0|1 0|1 0|0 1|0 1|1 0|1 0|1 0|0 0|1 0
resulting in
-
grch38#chr8 36377478 >601>606 GTTTCTTGAAAAACCAAATGT GTTTCTTGAAAAACCAAAGGT,G,GTTTCTTGAAAAACCAAAGGT 60 . AC=20,
1,20;AF=0.224719,0.011236,0.227273;AN=89,89,88;AT=>601>602>603>605>606,>601>602>604>605>606,>601>602>603>605>606
,>601>606,>602>603>605,>602>604>605;NS=45;LV=0;MULTI=ALTPROBLEM;combined=36377478-36377496 GT 0|0 0|0 0|0 0|0
0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 3|3 0|0 0|0 0|0 0|0 3|0 3|0 0|2 0|0 0|3 0|3 3|3 3|3
0|0 3|3 0|0 0|3 0|3 0|0 3|0 3|3 0|3 0|3 0|0 0|3 0
This is a combination of:
-
grch38#chr8 36377478 >601>606 GTTTCTTGAAAAACCAAATGT GTTTCTTGAAAAACCAAAGGT,G 60 . AC=20,1;AF=0.224719,0.011236
;AN=89;AT=>601>602>603>605>606,>601>602>604>605>606,>601>606;NS=45;LV=0 GT 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0
0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 1|1 0|0 0|0 0|0 0|0 1|0 1|0 0|2 0|0 0|1 0|1 1|1 1|1 0|0 1|1 0|0 0|1 0|1
0|0 1|0 1|1 0|1 0|1 0|0 0|1 0
grch38#chr8 36377496 >602>605 T G 60 . AC=20;AF=0.227273;AN=88;AT=>602>603>605,>602>604>605;NS=45;LV=1;PS=>60
1>606 GT 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 1|1 0|0 0|0 0|0 0|0 1|0 1|
0 0|. 0|0 0|1 0|1 1|1 1|1 0|0 1|1 0|0 0|1 0|1 0|0 1|0 1|1 0|1 0|1 0|0 0|1 0
Where the ALTs end up being a duplication and there is some
overlap in the genotype calling.
One future solution might be to have vcfcreatemulti ignore SNPs,
or only take the first one, but that somewhat would do away with pointing
out complex arrangements. Another solution might be to edit the ALTs and
merge ALT-SNP1 into ALT-SNP2 so we get ACTGCCTA. Contributions and ideas are
welcome!
Having a think about this: the safest approach is to backtrack on
a conflict and leave it alone. So, when a variant comes up that conflicts
with the combined record (so far) we should drop merging that variant and
leave it alone. This will typically happen with a long ALT that overlaps
many SNPs. We could come up with all types of solutions, but the point of
this algorithm is to `fix' the obvious cases. At this point we continue and
show the MULTI=ALTPROBLEM info field. It is not satisfactory and it is slow
too. We can have a stab at the backtrack in the future.
run_stdout(“vcfcreatemulti
../samples/grch38#chr8_36353854-36453166-bcftools-normalised.vcf”,
ext=“vcf”, uniq=2) output in vcfcreatemulti_2.vcf
run_stdout(“vcfcreatemulti ../samples/sample.vcf”,
ext=“vcf”, uniq=3) output in vcfcreatemulti_3.vcf
-
Check if the legacy version is still the same. Note it only retains the first genotype and has duplicate 'CC' alt alleles. INFO fields are not correct either.
```python
>>> sh("../build/vcfcreatemulti --legacy ../samples/10158243-after-vcfwave.vcf|grep -v ^\#")
grch38#chr4 10158244 >3655>3662_1 CCCCCACCCCCACC CC,C,CC,CCCCCACC,CCCCCACCCCCAC,CCCCCACCCCCACA 60 . AC=1;AF=0.011236;AN=89;AT=>3655>3656>3657>3660>3662;NS=45;LV=0;ORIGIN=grch38#chr4:10158243;LEN=12;INV=0;TYPE=del;combined=10158244-10158257 GT 0|0 0|0 0|0 0|0 1|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0|0 0
If you get an error like
-
thread 502 panic: attempt to unwrap error: MultiAltNotSupported
It means the input file already contains multi-allele VCF records.
To split these you can run a command such as bcftools norm -m- to normalise
the VCF records and split out multiple ALT alleles into separate VCF
records. Finally use vcfcreatemulti to create multi-allele VCF
records again.
See `caveat' section above.
Your VCF already contains multi-allele entries - bring them back
to one single ALT per record/line.
Copyright 2022-2024 (C) Erik Garrison, Pjotr Prins and vcflib
contributors. MIT licensed.
Erik Garrison, Pjotr Prins and other vcflib contributors.
Visit the GSP FreeBSD Man Page Interface. Output converted with ManDoc.
|