GSP
Quick Navigator

Search Site

Unix VPS
A - Starter
B - Basic
C - Preferred
D - Commercial
MPS - Dedicated
* Sign Up! *

Support
Customer Portal
Contact Us
Online Help
Handbooks
Domain Status
Man Pages

FAQ
Virtual Servers
Pricing
Billing
Technical

Network
Facilities
Connectivity
Topology Map

Miscellaneous
Server Agreement
Year 2038
Credits
 

USA Flag

 

 

Man Pages
Bio::Seq::PrimedSeq(3) User Contributed Perl Documentation Bio::Seq::PrimedSeq(3)

Bio::Seq::PrimedSeq - A sequence and a pair of primers matching on it

  use Bio::Seq;
  use Bio::Seq::PrimedSeq;
  my $template = Bio::Seq->new( -seq => 'AGCTTTTCATTCTGACTGCAAC' );
  my $left     = Bio::Seq->new( -seq => 'AGCT' );
  my $right    = Bio::Seq->new( -seq => 'GTTGC' );
  my $primedseq = Bio::Seq::PrimedSeq->new(
          -seq          => $template,  # sequence object
          -left_primer  => $left,      # sequence or primer object
          -right_primer => $right      # sequence or primer object
  );
  # Get the primers as Bio::SeqFeature::Primer objects
  my @primer_objects = $primedseq->get_primer();
  # Sequence object representing the PCR product, i.e. the section of the target
  # sequence contained between the primers (primers included)
  my $amplicon_seq = $primedseq->amplicon();
  print 'Got amplicon sequence: '.$amplicon_seq->seq."\n";
  # Amplicon should be: agctTTTCATTCTGACTgcaac

This module was created to address the fact that a primer is more than a SeqFeature and that there is a need to represent the primer-sequence complex and the attributes that are associated with the complex.

A PrimedSeq object is initialized with a target sequence and two primers. The location of the primers on the target sequence is calculated if needed so that one can then get the PCR product, or amplicon sequence. From the PrimedSeq object you can also retrieve information about melting temperatures and what not on each of the primers and the amplicon. The Bio::Tools::Primer3 module uses PrimedSeq objects extensively.

Note that this module does not simulate PCR. It assumes that the primers will match in a single location on the target sequence and does not understand degenerate primers.

  • Providing primers as sequence objects

    If the primers are specified as sequence objects, e.g. Bio::PrimarySeq or Bio::Seq, they are first converted to Bio::SeqFeature::Primer objects. Their location on the target sequence is then calculated and added to the Bio::SeqFeature::Primer objects, which you can retrieve using the get_primer() method.

  • Providing primers as primer objects

    Because of the limitations of specifying primers as sequence objects, the recommended method is to provide Bio::SeqFeature::Primer objects. If you did not record the location of the primers in the primer object, it will be calculated.

Bio::Seq::PrimedSeq was initially started by Chad Matsalla, and later improved on by Rob Edwards.

1.
Run Primer3 to get PrimedSeq objects:

  use Bio::SeqIO;
  use Bio::Tools::Run::Primer3;
  # Read a target sequences from a FASTA file
  my $file = shift || die "Need a file to read";
  my $seqin = Bio::SeqIO->new(-file => $file);
  my $seq = $seqin->next_seq;
  # Use Primer3 to design some primers
  my $primer3 = Bio::Tools::Run::Primer3->new(-seq => $seq);
  my $results = $primer3->run; # default parameters
  # Write all the results in a Genbank file
  my $seqout = Bio::SeqIO->new(-file => ">primed_sequence.gbk", 
                               -format => 'genbank');
  while (my $primedseq = $results->next_primer) {
     $seqout->write_seq( $primedseq->annotated_seq );
  }
    
2.
Create a genbank file for a sequence and its cognate primers:

  use Bio::SeqIO;
  use Bio::Seq::PrimedSeq;
  # Read a FASTA file that contains the target sequence and its two primers
  my $file = shift || die "$0 <file>";
  my $seqin = Bio::SeqIO->new(-file => $file);
  my ($template, $leftprimer, $rightprimer) = 
        ($seqin->next_seq, $seqin->next_seq, $seqin->next_seq);
  # Set up a PrimedSeq object
  my $primedseq = Bio::Seq::PrimedSeq->new(-seq => $template, 
                                           -left_primer => $leftprimer,
                                           -right_primer => $rightprimer);
  # Write the sequences in an output Genbank file
  my $seqout = Bio::SeqIO->new(-file => ">primed_sequence.gbk",
                               -format => 'genbank');
  $seqout->write_seq($primedseq->annotated_sequence);
    

User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated.

  bioperl-l@bioperl.org                  - General discussion
  http://bioperl.org/wiki/Mailing_lists  - About the mailing lists

Please direct usage questions or support issues to the mailing list:

bioperl-l@bioperl.org

rather than to the module maintainer directly. Many experienced and reponsive experts will be able look at the problem and quickly address it. Please include a thorough description of the problem with code and data examples if at all possible.

Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via the web:

  https://github.com/bioperl/bioperl-live/issues

Rob Edwards, redwards@utmem.edu

Based on a module written by Chad Matsalla, bioinformatics1@dieselwurks.com

The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _

 Title   : new()
 Usage   : my $primedseq = Bio::SeqFeature::Primer->new( 
                            -seq => $sequence,
                            -left_primer => $left_primer,
                            -right_primer => $right_primer
           );
 Function: Construct a primed sequence.
 Returns : A Bio::Seq::PrimedSeq object
 Args    :  -seq => a Bio::Seq object (required)
            -left_primer => a Bio::SeqFeature::Primer or sequence object (required)
            -right_primer => a Bio::SeqFeature::Primer or sequence object (required)
           If you pass a sequence object to specify a primer, it will be used to
           construct a Bio::SeqFeature::Primer that you can retrieve with the
           L<get_primer> method.
           Many other parameters can be included including all of the output
           parameters from the primer3 program (see L<Bio::Tools::Primer3>). At
           the moment these parameters will simply be stored and do anything.

 Title   : get_primer();
 Usage   :  my @primers = $primedseq->get_primer();
              or
            my $primer = $primedseq->get_primer('-left_primer');
 Function: Get the primers associated with the PrimedSeq object.
 Returns : A Bio::SeqFeature::Primer object
 Args    : For the left primer, use: l, left, left_primer or -left_primer
           For the right primer, use: r, right, right_primer or -right_primer
           For both primers [default], use: b, both, both_primers or -both_primers

 Title   : annotated_sequence
 Usage   : my $annotated_sequence_object = $primedseq->annotate_sequence();
 Function: Get an annotated sequence object containing the left and right
           primers
 Returns : An annotated sequence object or 0 if not defined.
 Args    : 
 Note    : Use this method to return a sequence object that you can write
           out (e.g. in GenBank format). See the example above.

 Title   : amplicon
 Usage   : my $amplicon = $primedseq->amplicon();
 Function: Retrieve the amplicon as a sequence object. The amplicon sequnce is
           only the section of the target sequence between the primer matches
           (primers included).
 Returns : A Bio::Seq object. To get the sequence use $amplicon->seq
 Args    : None
 Note    :

 Title   : seq
 Usage   : my $seqobj = $primedseq->seq();
 Function: Retrieve the target sequence as a sequence object
 Returns : A seq object. To get the sequence use $seqobj->seq
 Args    : None
 Note    :

 Title   : _place_primers
 Usage   : $self->_place_primers();
 Function: An internal method to place the primers on the sequence and 
           set up the ranges of the sequences
 Returns : Nothing
 Args    : None
 Note    : Internal use only
2021-02-03 perl v5.42.2

Search for    or go to Top of page |  Section 3 |  Main Index

Powered by GSP Visit the GSP FreeBSD Man Page Interface.
Output converted with ManDoc.