GSP
Quick Navigator

Search Site

Unix VPS
A - Starter
B - Basic
C - Preferred
D - Commercial
MPS - Dedicated
Previous VPSs
* Sign Up! *

Support
Contact Us
Online Help
Handbooks
Domain Status
Man Pages

FAQ
Virtual Servers
Pricing
Billing
Technical

Network
Facilities
Connectivity
Topology Map

Miscellaneous
Server Agreement
Year 2038
Credits
 

USA Flag

 

 

Man Pages
MCE::Relay(3) User Contributed Perl Documentation MCE::Relay(3)

MCE::Relay - Extends Many-Core Engine with relay capabilities

This document describes MCE::Relay version 1.901

 use MCE::Flow;
 my $file = shift || \*STDIN;
 ## Line Count #######################################
 mce_flow_f {
    max_workers => 4,
    use_slurpio => 1,
    init_relay  => 0,
 },
 sub {
    my ($mce, $slurp_ref, $chunk_id) = @_;
    my $line_count = ($$slurp_ref =~ tr/\n//);
    ## Receive and pass on updated information.
    my $lines_read = MCE::relay { $_ += $line_count };
 }, $file;
 my $total_lines = MCE->relay_final;
 print {*STDERR} "$total_lines\n";
 ## Orderly Action ###################################
 $| = 1; # Important, must flush output immediately.
 mce_flow_f {
    max_workers => 2,
    use_slurpio => 1,
    init_relay  => 0,
 },
 sub {
    my ($mce, $slurp_ref, $chunk_id) = @_;
    ## The relay value is relayed and remains 0.
    ## Writes to STDOUT orderly.
    MCE->relay_lock;
    print $$slurp_ref;
    MCE->relay_unlock;
 }, $file;

This module enables workers to receive and pass on information orderly with zero involvement by the manager process while running. The module is loaded automatically when MCE option "init_relay" is specified.

All workers (belonging to task_id 0) must participate when relaying data.

Relaying is not meant for passing big data. The last worker will stall if exceeding the buffer size for the socket. Not exceeding 16 KiB - 7 is safe across all platforms.

$mce->relay ( sub { code } )

Relay is enabled by defining the init_relay option which takes a hash or array reference, or a scalar value. Relaying is orderly and driven by chunk_id when processing data, otherwise task_wid. Omitting the code block (e.g. MCE::relay) relays forward.

Below, relaying multiple values via a HASH reference.

 use MCE::Flow max_workers => 4;
 mce_flow {
    init_relay => { p => 0, e => 0 },
 },
 sub {
    my $wid = MCE->wid;
    my $pass = $wid % 3;  # simulate work
    my $errs = $wid % 2;
    ## relay (include the trailing semicolon)
    my %last_rpt = MCE::relay { $_->{p} += $pass; $_->{e} += $errs };
    MCE->print("$wid: passed $pass, errors $errs\n");
    return;
 };
 my %results = MCE->relay_final;
 print "   passed $results{p}, errors $results{e} final\n\n";
 -- Output
 1: passed 1, errors 1
 2: passed 2, errors 0
 3: passed 0, errors 1
 4: passed 1, errors 0
    passed 4, errors 2 final

Or multiple values via an ARRAY reference.

 use MCE::Flow max_workers => 4;
 mce_flow {
    init_relay => [ 0, 0 ],
 },
 sub {
    my $wid = MCE->wid;
    ## do work
    my $pass = $wid % 3;
    my $errs = $wid % 2;
    ## relay
    my @last_rpt = MCE::relay { $_->[0] += $pass; $_->[1] += $errs };
    MCE->print("$wid: passed $pass, errors $errs\n");
    return;
 };
 my ($pass, $errs) = MCE->relay_final;
 print "   passed $pass, errors $errs final\n\n";
 -- Output
 1: passed 1, errors 1
 2: passed 2, errors 0
 3: passed 0, errors 1
 4: passed 1, errors 0
    passed 4, errors 2 final

Or simply a scalar value.

 use MCE::Flow max_workers => 4;
 mce_flow {
    init_relay => 0,
 },
 sub {
    my $wid = MCE->wid;
    ## do work
    my $bytes_read = 1000 + ((MCE->wid % 3) * 3);
    ## relay
    my $last_offset = MCE::relay { $_ += $bytes_read };
    ## output
    MCE->print("$wid: $bytes_read\n");
    return;
 };
 my $total = MCE->relay_final;
 print "   $total size\n\n";
 -- Output
 1: 1003
 2: 1006
 3: 1000
 4: 1003
    4012 size
$mce->relay_final ( void )

Call this method to obtain the final relay value(s) after running. See included example findnull.pl for another use case.

 use MCE max_workers => 4;
 my $mce = MCE->new(
    init_relay => [ 0, 100 ],       ## initial values (two counters)
    user_func => sub {
       my ($mce) = @_;
       ## do work
       my ($acc1, $acc2) = (10, 20);
       ## relay to next worker
       MCE::relay { $_->[0] += $acc1; $_->[1] += $acc2 };
       return;
    }
 )->run;
 my ($cnt1, $cnt2) = $mce->relay_final;
 print "$cnt1 : $cnt2\n";
 -- Output
 40 : 180
$mce->relay_recv ( void )

Call this method to obtain the next relay value before relaying. This allows serial-code to be processed orderly between workers. The following is a parallel demonstration for the fasta-benchmark on the web.

 # perl fasta.pl 25000000
 # The Computer Language Benchmarks game
 # https://benchmarksgame-team.pages.debian.net/benchmarksgame/
 #
 # contributed by Barry Walsh
 # port of fasta.rb #6
 #
 # MCE::Flow version by Mario Roy
 # requires MCE 1.807+
 # requires MCE::Shared 1.806+
 use strict;
 use warnings;
 use feature 'say';
 use MCE::Flow;
 use MCE::Shared;
 use MCE::Candy;
 use constant IM => 139968;
 use constant IA => 3877;
 use constant IC => 29573;
 my $LAST = MCE::Shared->scalar( 42 );
 my $alu =
    'GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG' .
    'GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA' .
    'CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT' .
    'ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA' .
    'GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG' .
    'AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC' .
    'AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA';
 my $iub = [
    [ 'a', 0.27 ], [ 'c', 0.12 ], [ 'g', 0.12 ],
    [ 't', 0.27 ], [ 'B', 0.02 ], [ 'D', 0.02 ],
    [ 'H', 0.02 ], [ 'K', 0.02 ], [ 'M', 0.02 ],
    [ 'N', 0.02 ], [ 'R', 0.02 ], [ 'S', 0.02 ],
    [ 'V', 0.02 ], [ 'W', 0.02 ], [ 'Y', 0.02 ]
 ];
 my $homosapiens = [
    [ 'a', 0.3029549426680 ],
    [ 'c', 0.1979883004921 ],
    [ 'g', 0.1975473066391 ],
    [ 't', 0.3015094502008 ]
 ];
 sub make_repeat_fasta {
    my ( $src, $n ) = @_;
    my $width = qr/(.{1,60})/;
    my $l     = length $src;
    my $s     = $src x ( ($n / $l) + 1 );
    substr( $s, $n, $l ) = '';
    while ( $s =~ m/$width/g ) { say $1 }
 }
 sub make_random_fasta {
    my ( $table, $n ) = @_;
    my $rand   = undef;
    my $width  = 60;
    my $prob   = 0.0;
    my $output = '';
    my ( $c1, $c2, $last );
    $_->[1] = ( $prob += $_->[1] ) for @$table;
    $c1  = '$rand = ( $last = ( $last * IA + IC ) % IM ) / IM;';
    $c1 .= "\$output .= '$_->[0]', next if $_->[1] > \$rand;\n" for @$table;
    my $seq = MCE::Shared->sequence(
       { chunk_size => 2000, bounds_only => 1 },
       1, $n / $width
    );
    my $code1 = q{
       while ( 1 ) {
          # --------------------------------------------
          # Process code orderly between workers.
          # --------------------------------------------
          my $chunk_id = MCE->relay_recv;
          my ( $begin, $end ) = $seq->next;
          MCE->relay, last if ( !defined $begin );
          my $last = $LAST->get;
          my $temp = $last;
          # Pre-compute $LAST value for the next worker
          for ( 1 .. ( $end - $begin + 1 ) * $width ) {
             $temp = ( $temp * IA + IC ) % IM;
          }
          $LAST->set( $temp );
          # Increment chunk_id value
          MCE->relay( sub { $_ += 1 } );
          # --------------------------------------------
          # Also run code in parallel between workers.
          # --------------------------------------------
          for ( $begin .. $end ) {
             for ( 1 .. $width ) { !C! }
             $output .= "\n";
          }
          # --------------------------------------------
          # Display orderly.
          # --------------------------------------------
          MCE->gather( $chunk_id, $output );
          $output = '';
       }
    };
    $code1 =~ s/!C!/$c1/g;
    MCE::Flow->init(
       max_workers => 4, ## MCE::Util->get_ncpu || 4,
       gather      => MCE::Candy::out_iter_fh( \*STDOUT ),
       init_relay  => 1,
       use_threads => 0,
    );
    MCE::Flow->run( sub { eval $code1 } );
    MCE::Flow->finish;
    $last = $LAST->get;
    $c2  = '$rand = ( $last = ( $last * IA + IC ) % IM ) / IM;';
    $c2 .= "print('$_->[0]'), next if $_->[1] > \$rand;\n" for @$table;
    my $code2 = q{
       if ( $n % $width != 0 ) {
          for ( 1 .. $n % $width ) { !C! }
          print "\n";
       }
    };
    $code2 =~ s/!C!/$c2/g;
    eval $code2;
    $LAST->set( $last );
 }
 my $n = $ARGV[0] || 27;
 say ">ONE Homo sapiens alu";
 make_repeat_fasta( $alu, $n * 2 );
 say ">TWO IUB ambiguity codes";
 make_random_fasta( $iub, $n * 3 );
 say ">THREE Homo sapiens frequency";
 make_random_fasta( $homosapiens, $n * 5 );
$mce->relay_lock ( void )
$mce->relay_unlock ( void )

The "relay_lock" and "relay_unlock" methods, added to MCE 1.807, are aliases for "relay_recv" and "relay" respectively. Together, they allow one to perform an exclusive action prior to actual relaying of data.

Relaying is driven by "chunk_id" or "task_wid" when not processing input, as seen here.

 MCE->new(
    max_workers => 8,
    init_relay => 0,
    user_func => sub {
       MCE->relay_lock;
       MCE->say("wid: ", MCE->task_wid);
       MCE->relay_unlock( sub {
          $_ += 2;
       });
    }
 )->run;
 MCE->say("sum: ", MCE->relay_final);
 __END__
 wid: 1
 wid: 2
 wid: 3
 wid: 4
 wid: 5
 wid: 6
 wid: 7
 wid: 8
 sum: 16

Described above, "relay" takes a code block and combines "relay_lock" and "relay_unlock" into a single call. To make this more interesting, I define "init_relay" to a hash containing two key-value pairs.

 MCE->new(
    max_workers => 8,
    init_relay => { count => 0, total => 0 },
    user_func => sub {
       MCE->relay_lock;
       MCE->say("wid: ", MCE->task_wid);
       MCE->relay_unlock( sub {
          $_->{count} += 1;
          $_->{total} += 2;
       });
    }
 )->run;
 my %results = MCE->relay_final;
 MCE->say("count: ", $results{count});
 MCE->say("total: ", $results{total});
 __END__
 wid: 1
 wid: 2
 wid: 3
 wid: 4
 wid: 5
 wid: 6
 wid: 7
 wid: 8
 count: 8
 total: 16

Below, "user_func" is taken from the "cat.pl" MCE example. Incrementing the count is done only when the "-n" switch is passed to the script. Otherwise, output is displaced orderly and not necessary to update the $_ value if exclusive locking is all you need.

 user_func => sub {
    my ($mce, $chunk_ref, $chunk_id) = @_;
    if ($n_flag) {
       ## Relays the total lines read.
       my $output = ''; my $line_count = ($$chunk_ref =~ tr/\n//);
       my $lines_read = MCE::relay { $_ += $line_count };
       open my $fh, '<', $chunk_ref;
       $output .= sprintf "%6d\t%s", ++$lines_read, $_ while (<$fh>);
       close $fh;
       $output .= ":$chunk_id";
       MCE->do('display_chunk', $output);
    }
    else {
       ## The following is another way to have ordered output. Workers
       ## write directly to STDOUT exclusively without any involvement
       ## from the manager process. The statement(s) between relay_lock
       ## and relay_unlock run serially and most important orderly.
       MCE->relay_lock;      # alias for MCE->relay_recv
       print $$chunk_ref;    # ensure $| = 1 in script
       MCE->relay_unlock;    # alias for MCE->relay
    }
    return;
 }

The following is a variant of the fasta-benchmark demonstration shown above. Here, workers write exclusively and orderly to "STDOUT".

 # perl fasta.pl 25000000
 # The Computer Language Benchmarks game
 # https://benchmarksgame-team.pages.debian.net/benchmarksgame/
 #
 # contributed by Barry Walsh
 # port of fasta.rb #6
 #
 # MCE::Flow version by Mario Roy
 # requires MCE 1.807+
 # requires MCE::Shared 1.806+
 use strict;
 use warnings;
 use feature 'say';
 use MCE::Flow;
 use MCE::Shared;
 use constant IM => 139968;
 use constant IA => 3877;
 use constant IC => 29573;
 my $LAST = MCE::Shared->scalar( 42 );
 my $alu =
    'GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG' .
    'GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA' .
    'CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT' .
    'ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA' .
    'GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG' .
    'AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC' .
    'AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA';
 my $iub = [
    [ 'a', 0.27 ], [ 'c', 0.12 ], [ 'g', 0.12 ],
    [ 't', 0.27 ], [ 'B', 0.02 ], [ 'D', 0.02 ],
    [ 'H', 0.02 ], [ 'K', 0.02 ], [ 'M', 0.02 ],
    [ 'N', 0.02 ], [ 'R', 0.02 ], [ 'S', 0.02 ],
    [ 'V', 0.02 ], [ 'W', 0.02 ], [ 'Y', 0.02 ]
 ];
 my $homosapiens = [
    [ 'a', 0.3029549426680 ],
    [ 'c', 0.1979883004921 ],
    [ 'g', 0.1975473066391 ],
    [ 't', 0.3015094502008 ]
 ];
 sub make_repeat_fasta {
    my ( $src, $n ) = @_;
    my $width = qr/(.{1,60})/;
    my $l     = length $src;
    my $s     = $src x ( ($n / $l) + 1 );
    substr( $s, $n, $l ) = '';
    while ( $s =~ m/$width/g ) { say $1 }
 }
 sub make_random_fasta {
    my ( $table, $n ) = @_;
    my $rand   = undef;
    my $width  = 60;
    my $prob   = 0.0;
    my $output = '';
    my ( $c1, $c2, $last );
    $_->[1] = ( $prob += $_->[1] ) for @$table;
    $c1  = '$rand = ( $last = ( $last * IA + IC ) % IM ) / IM;';
    $c1 .= "\$output .= '$_->[0]', next if $_->[1] > \$rand;\n" for @$table;
    my $seq = MCE::Shared->sequence(
       { chunk_size => 2000, bounds_only => 1 },
       1, $n / $width
    );
    my $code1 = q{
       $| = 1; # Important, must flush output immediately.
       while ( 1 ) {
          # --------------------------------------------
          # Process code orderly between workers.
          # --------------------------------------------
          MCE->relay_lock;
          my ( $begin, $end ) = $seq->next;
          print( $output ), $output = '' if ( length $output );
          MCE->relay_unlock, last if ( !defined $begin );
          my $last = $LAST->get;
          my $temp = $last;
          # Pre-compute $LAST value for the next worker
          for ( 1 .. ( $end - $begin + 1 ) * $width ) {
             $temp = ( $temp * IA + IC ) % IM;
          }
          $LAST->set( $temp );
          MCE->relay_unlock;
          # --------------------------------------------
          # Also run code in parallel.
          # --------------------------------------------
          for ( $begin .. $end ) {
             for ( 1 .. $width ) { !C! }
             $output .= "\n";
          }
       }
    };
    $code1 =~ s/!C!/$c1/g;
    MCE::Flow->init(
       max_workers => 4, ## MCE::Util->get_ncpu || 4,
       init_relay  => 0,
       use_threads => 0,
    );
    MCE::Flow->run( sub { eval $code1 } );
    MCE::Flow->finish;
    $last = $LAST->get;
    $c2  = '$rand = ( $last = ( $last * IA + IC ) % IM ) / IM;';
    $c2 .= "print('$_->[0]'), next if $_->[1] > \$rand;\n" for @$table;
    my $code2 = q{
       if ( $n % $width != 0 ) {
          for ( 1 .. $n % $width ) { !C! }
          print "\n";
       }
    };
    $code2 =~ s/!C!/$c2/g;
    eval $code2;
    $LAST->set( $last );
 }
 my $n = $ARGV[0] || 27;
 say ">ONE Homo sapiens alu";
 make_repeat_fasta( $alu, $n * 2 );
 say ">TWO IUB ambiguity codes";
 make_random_fasta( $iub, $n * 3 );
 say ">THREE Homo sapiens frequency";
 make_random_fasta( $homosapiens, $n * 5 );

I received a request from John Martel to process a large flat file and expand each record to many records based on splitting out items in field 4 delimited by semicolons. Each row in the output is given a unique ID starting with one while preserving output order.

 foo|field2|field3|item1;item2;item3;item4;itemN|field5|field6|field7
 bar|field2|field3|item1;item2;item3;item4;itemN|field5|field6|field7
 baz|field2|field3|item1;item2;item3;item4;itemN|field5|field6|field7
 ...
    
 000000000000001|item1|foo|field2|field3|field5|field6|field7
 000000000000002|item2|foo|field2|field3|field5|field6|field7
 000000000000003|item3|foo|field2|field3|field5|field6|field7
 000000000000004|item4|foo|field2|field3|field5|field6|field7
 000000000000005|itemN|foo|field2|field3|field5|field6|field7
 000000000000006|item1|bar|field2|field3|field5|field6|field7
 000000000000007|item2|bar|field2|field3|field5|field6|field7
 000000000000008|item3|bar|field2|field3|field5|field6|field7
 000000000000009|item4|bar|field2|field3|field5|field6|field7
 000000000000010|itemN|bar|field2|field3|field5|field6|field7
 000000000000011|item1|baz|field2|field3|field5|field6|field7
 000000000000012|item2|baz|field2|field3|field5|field6|field7
 000000000000013|item3|baz|field2|field3|field5|field6|field7
 000000000000014|item4|baz|field2|field3|field5|field6|field7
 000000000000015|itemN|baz|field2|field3|field5|field6|field7
 ...
    

This example configures a custom function for preserving output order. Unfortunately, the sprintf function alone involves extra CPU time causing the manager process to fall behind. Thus, workers may idle while waiting for the manager process to respond to the gather request.

 use strict;
 use warnings;
 use MCE::Loop;
 my $infile  = shift or die "Usage: $0 infile\n";
 my $newfile = 'output.dat';
 open my $fh_out, '>', $newfile or die "open error $newfile: $!\n";
 sub preserve_order {
     my ($fh) = @_;
     my ($order_id, $start_idx, $idx, %tmp) = (1, 1);
     return sub {
         my ($chunk_id, $aref) = @_;
         $tmp{ $chunk_id } = $aref;
         while ( my $aref = delete $tmp{ $order_id } ) {
             foreach my $line ( @{ $aref } ) {
                 $idx = sprintf "%015d", $start_idx++;
                 print $fh $idx, $line;
             }
             $order_id++;
         }
     }
 }
 MCE::Loop->init(
     chunk_size => 'auto', max_workers => 3,
     gather => preserve_order($fh_out)
 );
 mce_loop_f {
     my ($mce, $chunk_ref, $chunk_id) = @_;
     my @buf;
     foreach my $line (@{ $chunk_ref }) {
         $line =~ s/\r//g; chomp $line;
         my ($f1,$f2,$f3,$items,$f5,$f6,$f7) = split /\|/, $line;
         my @items_array = split /;/, $items;
         foreach my $item (@items_array) {
             push @buf, "|$item|$f1|$f2|$f3|$f5|$f6|$f7\n";
         }
     }
     MCE->gather($chunk_id, \@buf);
 } $infile;
 MCE::Loop->finish();
 close $fh_out;

In this example, workers obtain the current ID value and increment/relay for the next worker, ordered by chunk ID behind the scene. Workers call sprintf in parallel, allowing the manager process (out_iter_fh) to accommodate up to 32 workers and not fall behind.

Relay accounts for the worker handling the next chunk_id value. Therefore, do not call relay more than once per chunk. Doing so will cause IPC to stall.

 use strict;
 use warnings;
 use MCE::Loop;
 use MCE::Candy;
 my $infile  = shift or die "Usage: $0 infile\n";
 my $newfile = 'output.dat';
 open my $fh_out, '>', $newfile or die "open error $newfile: $!\n";
 MCE::Loop->init(
     chunk_size => 'auto', max_workers => 8,
     gather => MCE::Candy::out_iter_fh($fh_out),
     init_relay => 1
 );
 mce_loop_f {
     my ($mce, $chunk_ref, $chunk_id) = @_;
     my @lines;
     foreach my $line (@{ $chunk_ref }) {
         $line =~ s/\r//g; chomp $line;
         my ($f1,$f2,$f3,$items,$f5,$f6,$f7) = split /\|/, $line;
         my @items_array = split /;/, $items;
         foreach my $item (@items_array) {
             push @lines, "$item|$f1|$f2|$f3|$f5|$f6|$f7\n";
         }
     }
     my $idx = MCE::relay { $_ += scalar @lines };
     my $buf = '';
     foreach my $line ( @lines ) {
         $buf .= sprintf "%015d|%s", $idx++, $line
     }
     MCE->gather($chunk_id, $buf);
 } $infile;
 MCE::Loop->finish();
 close $fh_out;

MCE, MCE::Core

Mario E. Roy, <marioeroy AT gmail DOT com>

2025-01-02 perl v5.40.2

Search for    or go to Top of page |  Section 3 |  Main Index

Powered by GSP Visit the GSP FreeBSD Man Page Interface.
Output converted with ManDoc.